Sequence ID | >SRA1005286 |
Genome ID | SRR006907.152493 |
Search identical group | |
Phylum/Class | metagenomic water samples (SRP000427) |
Species | |
Start position on genome | 108 |
End posion on genome | 184 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aagttttaat |
tRNA gene sequence |
GCCGGTTTAGCTCAGTTGGCCAGAGCATCCGCCTTGTAAGCGGGAGGTCGTCAGTTCGAA |
Downstream region at tRNA end position |
agttttattg |
Secondary structure (Cloverleaf model) | >SRA1005286 Thr TGT t ACCA agttttattg G - C C - G C - G G - C G - C T - A T - A T A T C A G C C A T G A A | | | | G T C T C G G T C A G C G | | | | T T G G A G C C C A A AGGTC T + G C - G C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |