Sequence ID | >SRA1005321 |
Genome ID | SRR006907.177437 |
Search identical group | |
Phylum/Class | metagenomic water samples (SRP000427) |
Species | |
Start position on genome | 46 |
End posion on genome | 119 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aatccattgt |
tRNA gene sequence |
TGGGGAATCGTCTAACGGTAGGACTGTGGATTTTGATTCCACCTATTGGGGTTCGAATCC |
Downstream region at tRNA end position |
ttaacaagtt |
Secondary structure (Cloverleaf model) | >SRA1005321 Gln TTG t ACCA ttaacaagtt T - A G - C G - C G - C G - C A - T A - T T A T A T C C C A A A C | + | | | G C T C T G T G G G G C G + | | | T T G G G A C T A T CTAT G - C T - A G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |