Sequence ID | >W1810385581 |
Genome ID | PXOS01000020 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Mesoflavibacter sp. HG37 [PXOS] |
Start position on genome | 131313 |
End posion on genome | 131386 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ttaaataatt |
tRNA gene sequence |
GCGGGAGTAGCTCAGTTGGTAGAGCGTCAGCCTTCCAAGCTGAATGTCGCCGGTTCGAAC |
Downstream region at tRNA end position |
atatttaagc |
Secondary structure (Cloverleaf model) | >W1810385581 Gly TCC t TCta atatttaagc G - C C - G G - C G - C G - C A - T G - C C A T T G G C C A T G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T A G ATGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |