Sequence ID | >W1810393017 |
Genome ID | PYAW01000001 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Chitinophaga niastensis DSM 24859 [PYAW] |
Start position on genome | 1429935 |
End posion on genome | 1430009 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gaagggtttt |
tRNA gene sequence |
CGGGGCGTAGCGTAGCCCGGTATCGCGCCTGCTTTGGGAGCAGGAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
agaagcctta |
Secondary structure (Cloverleaf model) | >W1810393017 Pro TGG t ACtt agaagcctta C - G G - C G - C G - C G - C C - G G - C T A T C G T C C A C G A A | | | | | G C T G C G G C A G G C C | | | T T G T C G C G T A G AGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |