Sequence ID | >SRA1005425 |
Genome ID | SRR013521.1557 |
Search identical group | |
Phylum/Class | Viral metagenome of the Antarctic Lake Limnopolar in spring and summer? (SRP000593) |
Species | |
Start position on genome | 113 |
End posion on genome | 188 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
accacctttt |
tRNA gene sequence |
GCCGTTTTAGCTCAGTTGGTAGAGCAACTGTTTTGTAAACAGTAGGTCCCCAGTTCGAAT |
Downstream region at tRNA end position |
aatgtttgaa |
Secondary structure (Cloverleaf model) | >SRA1005425 Thr TGT t TCCA aatgtttgaa G - C C - G C - G G - C T + G T - A T - A T A T G G G T C A T G A A | | | | | G T C T C G C C C A G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |