| Sequence ID | >SRA1005443 |
| Genome ID | SRR014584.8618 |
| Phylum/Class | Metagenomic analysis of viruses in reclaimed water (SRP000673) |
| Species | |
| Start position on genome | 86 |
| End posion on genome | 159 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
cgcttgatat |
| tRNA gene sequence |
TGCGGGGTGGAGCAGCGGGCAGCTCGCCAGGCTCATAACCTGGAGGTCACTGGTTCAATT |
| Downstream region at tRNA end position |
gtctaggccg |
| Secondary structure (Cloverleaf model) | >SRA1005443 Met CAT
t ACac gtctaggccg
T - A
G - C
C - G
G - C
G - C
G + T
G - C T T
T T G A C C A
C G A G | | | | | A
G C G A G A C T G G C
G | | | | T T
G G C T C
C A G AGGTC
C - G
C - G
A - T
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |