Sequence ID | >SRA1005443 |
Genome ID | SRR014584.8618 |
Search identical group | |
Phylum/Class | Metagenomic analysis of viruses in reclaimed water (SRP000673) |
Species | |
Start position on genome | 86 |
End posion on genome | 159 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgcttgatat |
tRNA gene sequence |
TGCGGGGTGGAGCAGCGGGCAGCTCGCCAGGCTCATAACCTGGAGGTCACTGGTTCAATT |
Downstream region at tRNA end position |
gtctaggccg |
Secondary structure (Cloverleaf model) | >SRA1005443 Met CAT t ACac gtctaggccg T - A G - C C - G G - C G - C G + T G - C T T T T G A C C A C G A G | | | | | A G C G A G A C T G G C G | | | | T T G G C T C C A G AGGTC C - G C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |