Sequence ID | >SRA1005540 |
Genome ID | SRR014584.168764 |
Search identical group | |
Phylum/Class | Metagenomic analysis of viruses in reclaimed water (SRP000673) |
Species | |
Start position on genome | 152 |
End posion on genome | 76 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aggaacacgg |
tRNA gene sequence |
TGCAGGGTGACGCAGTGGTCTAGCGTGCGAGTCTCATAATCTCGAAGTCGCGGGTTCGAA |
Downstream region at tRNA end position |
agacaaacga |
Secondary structure (Cloverleaf model) | >SRA1005540 Met CAT g ACAA agacaaacga T T G - C C - G A - T G - C G - C G - C T A T C G C C C A T G A G | | | | | G G C G C A G C G G G C G | | | | T T T G C G T C T A G AAGTC C - G G - C A - T G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |