Sequence ID | >W1810413464 |
Genome ID | PYOG01000012 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Photobacterium damselae ATCC 33539 [PYOG] |
Start position on genome | 95485 |
End posion on genome | 95409 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
acacaatgat |
tRNA gene sequence |
GCGCCCTTAGCTCAGCTGGATAGAGCACGTCCCTTCTAAGGATGTGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
tttcctcttc |
Secondary structure (Cloverleaf model) | >W1810413464 Arg TCT t GCCA tttcctcttc G + T C - G G - C C - G C - G C - G T - A T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A TGGTC C - G G + T T - A C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |