Sequence ID | >SRA1005652 |
Genome ID | SRR014586.80505 |
Search identical group | |
Phylum/Class | Metagenomic analysis of viruses in reclaimed water (SRP000673) |
Species | |
Start position on genome | 74 |
End posion on genome | 160 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
actcagtaat |
tRNA gene sequence |
GCACTCGTGGCGAAACTGGTAACCGCACTCGTCTTCTAAACGAGCATCTGGAAGGATTTG |
Downstream region at tRNA end position |
ctcagaactc |
Secondary structure (Cloverleaf model) | >SRA1005652 Arg TCT t ACTA ctcagaactc G - C C - G A - T C - G T - A C - G G - C T A T C G C C C A C A A G | | | | | G T A G C G G C G G G C G | | | T T G C C G C T A A A CATCTGGAAGGATTT C - G T - A C - G G - C T - A C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |