Sequence ID | >SRA1005719 |
Genome ID | SRR014586.196875 |
Search identical group | |
Phylum/Class | Metagenomic analysis of viruses in reclaimed water (SRP000673) |
Species | |
Start position on genome | 126 |
End posion on genome | 52 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ctccaaccat |
tRNA gene sequence |
GGGCGAATAGTGATAGTGGTAGCACACTGCACTTGCAATGCAGTAGTCTGAGTTCGATTC |
Downstream region at tRNA end position |
agtaccggaa |
Secondary structure (Cloverleaf model) | >SRA1005719 Ala TGC t ACCA agtaccggaa G - C G - C G + T C - G G + T A - T A - T T T T G A C T C A G A T A | | | | | G T A G T G C T G A G C G | | | T T G G C A C T A A TAGT C - G T - A G - C C - G A - T C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |