Sequence ID | >SRA1005731 |
Genome ID | SRR014586.206770 |
Search identical group | |
Phylum/Class | Metagenomic analysis of viruses in reclaimed water (SRP000673) |
Species | |
Start position on genome | 107 |
End posion on genome | 32 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcagctaaac |
tRNA gene sequence |
AGTGCGGTAGAGCAGTTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGCAGGTTCGAGT |
Downstream region at tRNA end position |
aaggtaggat |
Secondary structure (Cloverleaf model) | >SRA1005731 Met CAT c ACAA aaggtaggat A C G - C T + G G - C C - G G - C G - C T G T C G T C C A T G A A | | | | | G T C G A G G C A G G C G | | | | T T G G C T C T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |