Sequence ID | >W1810424643 |
Genome ID | PYUQ02000010 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas sp. SL1 [PYUQ] |
Start position on genome | 29235 |
End posion on genome | 29321 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ctcgtgtttc |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGCTAGTGTCCTTACGGACGTG |
Downstream region at tRNA end position |
ttcatcgctc |
Secondary structure (Cloverleaf model) | >W1810424643 Leu CAG c ACCA ttcatcgctc G - C C - G C - G C - G A - T G - C G - C T G T T C T C C A T A A G + | | | | A T G G C G G G A G G C G | | | T T G A C G C T A G G TGTCCTTACGGACGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |