| Sequence ID | >SRA1005898 |
| Genome ID | SRR014589.27183 |
| Phylum/Class | Metagenomic analysis of viruses in reclaimed water (SRP000673) |
| Species | |
| Start position on genome | 5 |
| End posion on genome | 81 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
nnnnnnaaaa |
| tRNA gene sequence |
GGGCTGTTAGTTCAGTTGGCTAGAACGTCTGATTTGCATTCAGAAGGTCATCGGTTCGAC |
| Downstream region at tRNA end position |
aatgcttctt |
| Secondary structure (Cloverleaf model) | >SRA1005898 Ala TGC
a ACAA aatgcttctt
G - C
G - C
G + T
C - G
T + G
G - C
T - A T C
T T G G C C A
T G A A | + | | | G
T C T T G A T C G G C
G | | | | T T
G G A A C
C T A G AGGTC
T - A
C - G
T - A
G - C
A - T
T T
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |