Sequence ID | >W1810444456 |
Genome ID | PZJR01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salinicola sp. CPA57 [PZJR] |
Start position on genome | 413295 |
End posion on genome | 413220 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgttggcgaa |
tRNA gene sequence |
GGCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
tcaatgctgg |
Secondary structure (Cloverleaf model) | >W1810444456 Phe GAA a ACCA tcaatgctgg G - C G - C C - G C - G A - T G - C A - T T T T C T G C C A T G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC G - C G - C G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |