Sequence ID | >SRA1005989 |
Genome ID | SRR014589.91859 |
Search identical group | |
Phylum/Class | Metagenomic analysis of viruses in reclaimed water (SRP000673) |
Species | |
Start position on genome | 279 |
End posion on genome | 202 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aagacaatat |
tRNA gene sequence |
GGCGGCGTAGCTCAGCTGGCTAGAGCGTACGGTTCATACCCGTAAGTCGGGGGGGTTCGA |
Downstream region at tRNA end position |
gataaatttg |
Secondary structure (Cloverleaf model) | >SRA1005989 Met CAT t ACTA gataaatttg G + T G - C C - G G - C G - C C - G G + T C G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C T A G AGTCGG T - A A - T C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |