Sequence ID | >SRA1006014 |
Genome ID | SRR014589.115561 |
Search identical group | |
Phylum/Class | Metagenomic analysis of viruses in reclaimed water (SRP000673) |
Species | |
Start position on genome | 7 |
End posion on genome | 83 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
nnnnacatta |
tRNA gene sequence |
GGGCCCTTAGCTCAGCTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
attaataaac |
Secondary structure (Cloverleaf model) | >SRA1006014 Ile GAT a ACCA attaataaac G - C G - C G - C C - G C - G C - G T - A T G T T C A C C A C G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |