| Sequence ID | >W1810452307 |
| Genome ID | PZPL01000001 |
| Phylum/Class | Actinomycetota |
| Species | Rathayibacter caricis DSM 15933 [PZPL] |
| Start position on genome | 457262 |
| End posion on genome | 457335 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
tgcagcttcc |
| tRNA gene sequence |
GGCCCCATCGTTTAGTGGCCTAGGACGCCGCCCTTTCACGGCGGTAGCACGGGTTCGAAT |
| Downstream region at tRNA end position |
agacgacacc |
| Secondary structure (Cloverleaf model) | >W1810452307 Glu TTC
c ACga agacgacacc
G - C
G + T
C - G
C - G
C - G
C - G
A - T T A
T T G C C C A
T G A C | | | | | G
G T T T G A C G G G C
G + + | | T T
C G G A C
C T A G TAGC
C - G
C - G
G - C
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |