Sequence ID | >SRA1006120 |
Genome ID | SRR014589.219980 |
Search identical group | |
Phylum/Class | Metagenomic analysis of viruses in reclaimed water (SRP000673) |
Species | |
Start position on genome | 66 |
End posion on genome | 141 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ataaccttaT |
tRNA gene sequence |
CGGGACGTAGCTCAGCTTGGTAGAGCACCTGCTTTGGGAGCAGGGGGTCGCATGTTCAAA |
Downstream region at tRNA end position |
acgcgcgggc |
Secondary structure (Cloverleaf model) | >SRA1006120 Pro TGG T ATag acgcgcgggc C - G G - C G - C G - C A - T C - G G - C T A T T G T G C A C G A A + | | + | A T C T C G G C A T G C T | | | | T T G G A G C G T A A GGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |