Sequence ID | >W1810463093 |
Genome ID | PZZH01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterococcus faecalis B2535 [PZZH] |
Start position on genome | 2613067 |
End posion on genome | 2612996 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cgagagttaa |
tRNA gene sequence |
TGGAGCATAGCTTAATCGGCAGAGCAGCGGTCTCCAAAACCGTTGGTATAGGTTCGAGTC |
Downstream region at tRNA end position |
gtggcataag |
Secondary structure (Cloverleaf model) | >W1810463093 Trp CCA a Gtaa gtggcataag T - A G - C G - C A - T G + T C - G A - T T G T T A T C C A T A A A | | | | | G C T T C G A T A G G C G + | | | T T G G A G C C A A TGGT G + T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |