Sequence ID | >W1810463465 |
Genome ID | PZZO01000005 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Marinobacter sp. PT19DW [PZZO] |
Start position on genome | 141178 |
End posion on genome | 141251 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gatcttttcc |
tRNA gene sequence |
GGCGCGGTGGCAGAGTGGTTATGCAGCGGACTGCAACTCCGTGTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
ttattttctc |
Secondary structure (Cloverleaf model) | >W1810463465 Cys GCA c TCCA ttattttctc G - C G - C C - G G - C C - G G - C G - C T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T T A GTAC G + T C - G G - C G - C A - T C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |