| Sequence ID | >SRA1006154 |
| Genome ID | SRR016610.104274 |
| Phylum/Class | Metagenomic analysis of deep-sea hydrothermal vent prokaryotes (SRP000749) |
| Species | |
| Start position on genome | 92 |
| End posion on genome | 16 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
tttttatttt |
| tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGTAGAGCGTCTGCCTTGCACGTAGAAGGTTCGCTGGTTCGAT |
| Downstream region at tRNA end position |
aaaataaaag |
| Secondary structure (Cloverleaf model) | >SRA1006154 Ala TGC
t ACCA aaaataaaag
G - C
G - C
G + T
G - C
G - C
T + G
G - C C T
T T G A C C A
T G A A + | | | | G
T C T C G G C T G G C
G | | | | T T
G G A G C
T A G AGGTTC
T - A
C - G
T - A
G + T
C - G
C C
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |