Sequence ID | >SRA1006201 |
Genome ID | SRR016610.239301 |
Search identical group | |
Phylum/Class | Metagenomic analysis of deep-sea hydrothermal vent prokaryotes (SRP000749) |
Species | |
Start position on genome | 7 |
End posion on genome | 83 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
nnnnttcgcg |
tRNA gene sequence |
GCGACCGTAGTTCAATTGGTTAGAGTGCCGGCTTGTGATGCCGGAAGTTGCGGGTTCAAG |
Downstream region at tRNA end position |
taatttcggc |
Secondary structure (Cloverleaf model) | >SRA1006201 His GTG g CCCA taatttcggc G - C C - G G - C A - T C - G C - G G - C T G T T G C C C A T A A A + | | | | A T C T T G G C G G G C G | | + + T T G G A G T T T A G AAGTT C - G C - G G - C G - C C - G T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |