| Sequence ID | >SRA1006202 |
| Genome ID | SRR016610.242712 |
| Phylum/Class | Metagenomic analysis of deep-sea hydrothermal vent prokaryotes (SRP000749) |
| Species | |
| Start position on genome | 75 |
| End posion on genome | 151 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
agccttcgcg |
| tRNA gene sequence |
GCGACCGTAGTTCAATTGGTTAGAGTGCCGGCTTGTGATGCCGGAAGTTGCGGGTTCAAG |
| Downstream region at tRNA end position |
taatttcggc |
| Secondary structure (Cloverleaf model) | >SRA1006202 His GTG
g CCCA taatttcggc
G - C
C - G
G - C
A - T
C - G
C - G
G - C T G
T T G C C C A
T A A A + | | | | A
T C T T G G C G G G C
G | | + + T T
G G A G T
T T A G AAGTT
C - G
C - G
G - C
G - C
C - G
T T
T A
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |