| Sequence ID | >SRA1006203 |
| Genome ID | SRR016610.250605 |
| Phylum/Class | Metagenomic analysis of deep-sea hydrothermal vent prokaryotes (SRP000749) |
| Species | |
| Start position on genome | 42 |
| End posion on genome | 126 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
ggtccttcgt |
| tRNA gene sequence |
GCGGGCGTGGCGGAATTGGTAGACGCAGCAGGTTTAGGTCCTGCCATCGCAAGATGTGGG |
| Downstream region at tRNA end position |
gtcccgccgc |
| Secondary structure (Cloverleaf model) | >SRA1006203 Leu TAG
t ACCA gtcccgccgc
G - C
C - G
G - C
G - C
G - C
C - G
G - C T G
T T T C C C A
T A A G + + | | | G
T G G C G G G G G G C
G | | | T T
G A C G C
T A G A CATCGCAAGATGT
G - C
C - G
A - T
G - C
G - C
T T
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |