Sequence ID | >SRA1006226 |
Genome ID | SRR020488.2067 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 117 |
End posion on genome | 40 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tgagttctat |
tRNA gene sequence |
GGACCGGTAGTTCAGTTTGGTTAGAACGCCGCCCTGTCACGGCGGAGGTCGCGAGTTCGA |
Downstream region at tRNA end position |
tttttccatt |
Secondary structure (Cloverleaf model) | >SRA1006226 Asp GTC t GCCA tttttccatt G - C G - C A - T C - G C - G G - C G - C T G T T G C T C A T T G A A + | | | | G T C T T G G C G A G C G | | | | T T G G A A C T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |