Sequence ID | >W1810486153 |
Genome ID | QAXR01000004 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Geobacter sp. DSM 2909 [QAXR] |
Start position on genome | 125990 |
End posion on genome | 125904 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aatatttttt |
tRNA gene sequence |
GCGATCATGGCGGAATTGGTAGACGCACCAGCTTGAGGGGCTGGCGGGGGGTTCCCCGTG |
Downstream region at tRNA end position |
tcaagaattt |
Secondary structure (Cloverleaf model) | >W1810486153 Leu GAG t ACCA tcaagaattt G - C C - G G - C A - T T - A C - G A - T T C T C C C T C A T A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C T A G A CGGGGGGTTCCCCGT C - G C - G A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |