Sequence ID | >SRA1006431 |
Genome ID | SRR020488.84907 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 167 |
End posion on genome | 93 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aatatttttt |
tRNA gene sequence |
GGCCCGTTCGTCTAGTGGTTAGGACTCCAGGTTTTCATCCTGGCAACAGGAGTTCGATTC |
Downstream region at tRNA end position |
aaaactcaaa |
Secondary structure (Cloverleaf model) | >SRA1006431 Glu TTC t ACTA aaaactcaaa G + T G - C C - G C - G C - G G - C T - A T T T T C C T C A T G A C | | | | | G G T C T G A G G A G C G + | | | T T T G G A C T A T CAAC C - G C - G A - T G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |