Sequence ID | >SRA1006511 |
Genome ID | SRR020488.115194 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 114 |
End posion on genome | 199 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
caggcctgct |
tRNA gene sequence |
GCAGACGTCGCATAGCCTGGTATTGCGCCGGATTTGAAATCCGGTGTCCTAGTGACTCGG |
Downstream region at tRNA end position |
aactcagagg |
Secondary structure (Cloverleaf model) | >SRA1006511 Ser TGA t GCCA aactcagagg G - C C - G A - T G - C A - T C - G G - C T A T C T C T C A C G A C | + | | | A C T A C G G G G A G C T | | | T T G T T G C G T A G TGTCCTAGTGACTC C - G C - G G - C G - C A - T T A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |