Sequence ID | >W1810503410 |
Genome ID | QBKC01000003 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Nitrosospira sp. Nsp37 [QBKC] |
Start position on genome | 184659 |
End posion on genome | 184735 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gttataaccg |
tRNA gene sequence |
GGGTCTGTAGCTCAGTTGGTTAGAGCAGGGGACTCATAATCCCTTGGTCGCTGGTTCGAG |
Downstream region at tRNA end position |
atttattcaa |
Secondary structure (Cloverleaf model) | >W1810503410 Met CAT g ACCA atttattcaa G - C G - C G - C T - A C - G T - A G - C T G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T T A A TGGTC G + T G - C G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |