Sequence ID | >W1810504080 |
Genome ID | QBKP01000004 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Gemmobacter caeni DSM 21823 [QBKP] |
Start position on genome | 49896 |
End posion on genome | 49971 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ccgcaggcct |
tRNA gene sequence |
AGGGGTATAGCTCAGTTGGTAGAGCATCGGTCTCCAAAACCGAGGGTCGCGGGTTCAAGT |
Downstream region at tRNA end position |
ggcccttcca |
Secondary structure (Cloverleaf model) | >W1810504080 Trp CCA t GCCA ggcccttcca A - T G - C G - C G - C G - C T + G A - T T G T C G T C C A T G A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |