Sequence ID | >W1810517351 |
Genome ID | QCCD01000004 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus sp. AG-347-K16 [QCCD] |
Start position on genome | 43940 |
End posion on genome | 43870 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
attgcttaat |
tRNA gene sequence |
GCGGGCGTGGTTTAGTGGTAAAACCTCAGCCTTCCAAGCTGAAGATGCGGGTTCGATTCC |
Downstream region at tRNA end position |
gaataattta |
Secondary structure (Cloverleaf model) | >W1810517351 Gly TCC t Ttta gaataattta G - C C - G G - C G - C G - C C - G G - C T T T C G C C C A G A G | | | | | G T T T T G G C G G G C G | | | | T T G A A A C T A C AGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |