Sequence ID | >SRA1006684 |
Genome ID | SRR020488.176207 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 233 |
End posion on genome | 162 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tttatcataa |
tRNA gene sequence |
GGGCGATTAGCTCAGCGGTAGAGCGCCTGCCTTACAAGCAGGATGTCCCTGGTTCGAACC |
Downstream region at tRNA end position |
attatttttc |
Secondary structure (Cloverleaf model) | >SRA1006684 Val TAC a Attt attatttttc G - C G - C G - C C - G G - C A - T T - A C A T G G T C C A G A A | | | | G C C T C G C C T G G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |