Sequence ID | >SRA1006699 |
Genome ID | SRR020488.180805 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 123 |
End posion on genome | 47 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
taaaaaatta |
tRNA gene sequence |
CTCCCGGTAGCTCAGCTGGATAGAGCATCTGCCTTCTAAGCAGAGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
acaatggtgg |
Secondary structure (Cloverleaf model) | >SRA1006699 Arg TCT a GCCA acaatggtgg C - G T - A C - G C - G C - G G - C G - C T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTC T - A C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |