Sequence ID | >W1810522940 |
Genome ID | QCJX01000005 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus sp. AG-409-I11 [QCJX] |
Start position on genome | 46075 |
End posion on genome | 46004 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gtttcctttc |
tRNA gene sequence |
GGGCGATTAGCTCAGAGGTAGAGCACTACCTTGACACGGTAGGGGTCACTGGTTCGATTC |
Downstream region at tRNA end position |
acattgcagc |
Secondary structure (Cloverleaf model) | >W1810522940 Val GAC c Ataa acattgcagc G - C G - C G - C C - G G - C A - T T - A T T T T G A C C A G A A | | | | | G A C T C G A C T G G C G | | | | T T G G A G C T A A GGGTC C - G T - A A - T C - G C - G T C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |