| Sequence ID | >W1810523944 |
| Genome ID | QCLJ01000028 |
| Phylum/Class | Alphaproteobacteria |
| Species | Pelagibacteraceae bacterium AG-414-C04 [QCLJ] |
| Start position on genome | 8751 |
| End posion on genome | 8826 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
ctctataaat |
| tRNA gene sequence |
AGGAGTGTAGCTCAATTGGTAGAGCGCCGGTCTCCAAAACCGGAGGCTGAGGGTTCGAGT |
| Downstream region at tRNA end position |
attagagctt |
| Secondary structure (Cloverleaf model) | >W1810523944 Trp CCA
t GCCA attagagctt
A - T
G - C
G - C
A - T
G - C
T + G
G - C T G
T C T C C C A
T A A A | | | | | G
T C T C G G A G G G C
G | | | | T T
G G A G C
T A G AGGCT
C - G
C - G
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |