Sequence ID | >SRA1006735 |
Genome ID | SRR020488.190569 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 83 |
End posion on genome | 168 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
atttagattt |
tRNA gene sequence |
GCCGAAGTGGCGGAATTGGTAGACGCAGGGGATTCAAAATCCCCCGCCCCTTGGGTGTGA |
Downstream region at tRNA end position |
cttatattga |
Secondary structure (Cloverleaf model) | >SRA1006735 Leu CAA t ACCA cttatattga G - C C - G C - G G - C A - T A - T G - C T G T C T C T C A T A A G | | | | | G T G G C G G A G A G C G | | | T T G A C G C T A G A CGCCCCTTGGGTGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |