Sequence ID | >W1810524434 |
Genome ID | QCMB01000026 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus sp. AG-418-J17 [QCMB] |
Start position on genome | 12971 |
End posion on genome | 12896 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atattcccaT |
tRNA gene sequence |
GTCTCGGTAGCTCAGCTGGTTAGAGCGGCGGATTCATAGCCCGCAGGTCGCGTGTTCAAG |
Downstream region at tRNA end position |
tcaatactta |
Secondary structure (Cloverleaf model) | >W1810524434 Met CAT T ATtt tcaatactta G - C T - A C - G T - A C - G G - C G + T T G T C G C A C A C G A A | | | | | A T C T C G G C G T G C G | | | | T T G G A G C T T A G AGGTC G - C C - G G - C G - C A C T G T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |