| Sequence ID | >SRA1006748 |
| Genome ID | SRR020488.194730 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
135
|
|
End posion on genome
|
208
|
|
Amino Acid
|
Cys
|
|
Anticodon
|
GCA
|
|
Upstream region at tRNA start position
|
ggcacatgct
|
|
tRNA gene sequence
|
GGCGCGGTGGCGGAGTGGCTACGCACCGGCCTGCAAAGCCGTGTACACCGGTTCGATTCC GGTCCGCGCCTCCA
|
|
Downstream region at tRNA end position
|
cactgatccg
|
| Secondary structure (Cloverleaf model) | >SRA1006748 Cys GCA
t TCCA cactgatccg
G - C
G - C
C - G
G - C
C - G
G - C
G - C T T
T T G G C C A
G A G | | | | | G
T G G C G A C C G G C
G | | | T T
G A C G C
C T A GTAC
C T
C - G
G - C
G - C
C - G
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |