Sequence ID | >SRA1006755 |
Genome ID | SRR020488.197644 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 37 |
End posion on genome | 110 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cttgggtgct |
tRNA gene sequence |
GCGGGTGTAGTTCAGTGGTAGAACACTAGCCTTCCAAGCTGGTTGCGTGAGTTCGATTCT |
Downstream region at tRNA end position |
aaaaaaaatg |
Secondary structure (Cloverleaf model) | >SRA1006755 Gly TCC t TCCA aaaaaaaatg G - C C - G G - C G - C G - C T - A G - C T T T T A C T C A G A A + | | | | G T C T T G G T G A G C G | | | | T T G G A A C T A A TTGC C - G T + G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |