Sequence ID | >W1810527126 |
Genome ID | QCQK01000038 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus sp. AG-449-J16 [QCQK] |
Start position on genome | 3908 |
End posion on genome | 3835 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ctttgaaatT |
tRNA gene sequence |
GCCCTTGTAGCTCAGCGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCTCGGGTTCAAGTC |
Downstream region at tRNA end position |
acaaaaagta |
Secondary structure (Cloverleaf model) | >W1810527126 Thr GGT T ATga acaaaaagta G - C C - G C - G C - G T - A T + G G - C T G T A G C C C A G A A | | | | | A C C T C G T C G G G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |