Sequence ID | >W1810527345 |
Genome ID | QCQX01000005 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus sp. AG-459-A09 [QCQX] |
Start position on genome | 36494 |
End posion on genome | 36576 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
caaatagtgg |
tRNA gene sequence |
GGGTCGGTGCCCGAGTGGTTAAAGGGGGCGGACTGTAAATCCGCTGGCTCTGCCTACGTT |
Downstream region at tRNA end position |
ttttttcagc |
Secondary structure (Cloverleaf model) | >W1810527345 Tyr GTA g ACtt ttttttcagc G - C G - C G - C T + G C - G G - C G - C T A T C A A C C A T G A G | | | | | A G G C C C G T T G G C G | | | T T T A G G G T A A G TGGCTCTGCCTAC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |