Sequence ID | >W1810527512 |
Genome ID | QCRF01000001 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus sp. AG-459-N19 [QCRF] |
Start position on genome | 146588 |
End posion on genome | 146671 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
aaaacccttT |
tRNA gene sequence |
GCGGACGTGGCGGAATTGGTAGACGCGCACGTCTAAGGAGCGTGTGGCTTCGGCCTTGCG |
Downstream region at tRNA end position |
aatgtattct |
Secondary structure (Cloverleaf model) | >W1810527512 Leu AAG T ATta aatgtattct G - C C - G G - C G - C A - T C - G G - C T G T C G C T C A T A A G | | | | | A T G G C G G C G A G C G | | | T T G A C G C T A G G TGGCTTCGGCCTT C - G A - T C - G G - C T + G C A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |