| Sequence ID | >W1810527742 |
| Genome ID | QCRR01000021 |
| Phylum/Class | Cyanobacteriota |
| Species | Prochlorococcus sp. AG-463-F02 [QCRR] |
| Start position on genome | 15176 |
| End posion on genome | 15248 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
aacgcgacgc |
| tRNA gene sequence |
GCCGGGATAGCTCAGTTGGTAGAGCAGGCGACTGAAAATCGCCGTGTCCCCAGTTCAAAT |
| Downstream region at tRNA end position |
atttaagatg |
| Secondary structure (Cloverleaf model) | >W1810527742 Phe GAA
c Atca atttaagatg
G - C
C - G
C - G
G + T
G - C
G - C
A - T T A
T G G G T C A
T G A A | | | | | A
T C T C G C C C A G C
G | | | | T T
G G A G C
T A A GTGTC
G - C
G - C
C - G
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |