Sequence ID | >W1810528779 |
Genome ID | QCTN01000028 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus sp. AG-673-L20 [QCTN] |
Start position on genome | 8436 |
End posion on genome | 8346 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tagaagaacT |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGTAACTTT |
Downstream region at tRNA end position |
taatgcattt |
Secondary structure (Cloverleaf model) | >W1810528779 Ser GCT T GTtt taatgcattt G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G T C G G A G G G C G | | | T T T A A G C T G A G TACAGGAGGTAACTTTTGTC G + T C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |