| Sequence ID | >W1810530640 |
| Genome ID | QCWV01000078 |
| Phylum/Class | Bacteroidota |
| Species | Flavobacterium sp. WLB [QCWV] |
| Start position on genome | 4712 |
| End posion on genome | 4786 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
ccgtaatgag |
| tRNA gene sequence |
GCCGATGTAGCTCAGCTGGCTAGAGCAGCTGATTTGTAATCAGCAGGTCGTGGGTTCGAG |
| Downstream region at tRNA end position |
cggaaaacca |
| Secondary structure (Cloverleaf model) | >W1810530640 Thr TGT
g TCaa cggaaaacca
G - C
C - G
C - G
G - C
A - T
T - A
G + T T G
T C T C C C A
C G A A | | | | G
T C T C G G T G G G C
G | | | | T T
G G A G C
C T A A AGGTC
G - C
C - G
T - A
G - C
A - T
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |