Sequence ID | >SRA1006816 |
Genome ID | SRR020488.218970 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 55 |
End posion on genome | 140 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ctgataaaag |
tRNA gene sequence |
GGAGGGGTACCAAAGCGGTCAAATGGGGCGGGCTGTAAACCCGTTGACTTCGGTCTTCGA |
Downstream region at tRNA end position |
aaaaaatctt |
Secondary structure (Cloverleaf model) | >SRA1006816 Tyr GTA g ACCA aaaaaatctt G - C G - C A - T G - C G - C G - C G - C T A T C T T C C A C G A A | | | | | G G A A C C G A A G G C G | | | T T T A T G G C A A G TGACTTCGGTCTTC G + T C - G G - C G - C G - C C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |