| Sequence ID | >W1810533171 |
| Genome ID | QCZG01000012 |
| Phylum/Class | Bacillota |
| Species | Pueribacillus theae T8 [QCZG] |
| Start position on genome | 14602 |
| End posion on genome | 14675 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
ttttttgtat |
| tRNA gene sequence |
GGCCCCGTAGCTCAGGGGATAGAGCGTCGGTTTCCTAAACCGTGCGTCGCAGGTTCGATT |
| Downstream region at tRNA end position |
ataaactcat |
| Secondary structure (Cloverleaf model) | >W1810533171 Arg CCT
t GCtt ataaactcat
G - C
G - C
C - G
C - G
C - G
C - G
G - C T T
T C G T C C A
G G A A | | | | | G
G C T C G G C A G G C
G | | | | T T
A G A G C
T A G GCGTC
T T
C - G
G - C
G - C
T - A
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |