Sequence ID | >W1810533268 |
Genome ID | QCZH01000039 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium laiguense LB2P30 [QCZH] |
Start position on genome | 1832 |
End posion on genome | 1906 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gaataaagag |
tRNA gene sequence |
TGTCTCGTAGCTCAGCTGGTTAGAGTACTACACTGATAATGTAGGGGTCGACAGTTCGAG |
Downstream region at tRNA end position |
ttttagactt |
Secondary structure (Cloverleaf model) | >W1810533268 Ile GAT g ACta ttttagactt T - A G - C T - A C - G T - A C - G G - C T G T C T G T C A C G A A | | | | | G T C T C G G A C A G C G | | | + T T G G A G T T T A A GGGTC C - G T - A A - T C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |