Sequence ID | >W1810533287 |
Genome ID | QCZI01000006 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium psychrotolerans RB1R5 [QCZI] |
Start position on genome | 58106 |
End posion on genome | 58032 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
cggtgcattt |
tRNA gene sequence |
GGGGGATTAGCTCATTTGGCTAGAGCGCTTGCCTGGCAGGCAAGAGGTGGTCGGTTCGAA |
Downstream region at tRNA end position |
agtcccattt |
Secondary structure (Cloverleaf model) | >W1810533287 Ala GGC t ACaa agtcccattt G - C G - C G + T G - C G + T A - T T - A T A T T A G C C A T T A A + | | | | G T C T C G G T C G G C G | | | | T T G G A G C C T A G AGGTG C - G T - A T - A G - C C - G C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |