| Sequence ID | >SRA1006857 |
| Genome ID | SRR020488.237435 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
189
|
|
End posion on genome
|
113
|
|
Amino Acid
|
Val
|
|
Anticodon
|
TAC
|
|
Upstream region at tRNA start position
|
nattagctca
|
|
tRNA gene sequence
|
GGGCGCTTAGCTCAGTCCGGCAGAGCGCTTCCCTTACAAGGAAGAAGTCACAGGTTCAAA TCCTGTAGCGCCCACAA
|
|
Downstream region at tRNA end position
|
gggtttttca
|
| Secondary structure (Cloverleaf model) | >SRA1006857 Val TAC
a ACAA gggtttttca
G - C
G - C
G - C
C - G
G - C
C - G
T - A T A
T T G T C C A
T G A A | | | | | A
C C T C G A C A G G C
C | | | | T T
G G A G C
G C A G AAGTC
C - G
T - A
T - A
C - G
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |